Biology and Chemistry Workshop

From Hackerspace Brussels
Jump to: navigation, search

Biology and Chemistry Workshop
Sat 16 Oct 2010 14:00
till Sat 16 Oct 2010 19:00
Error creating thumbnail: File missing
Biology and Chemistry Workshop
Yet another Hsb Meetup!
HSB Brussels,Belgium

 Date changed to Saturday 16 of october


This will be a beginners workshop, things I (U_go) want to cover :

  • Biology for beginners
    • focus on genetics
    • theory on how to make GMOs
    • also have fun with microscopes
  • Chemistry for fun


  • Introduction on cells
  • Genetics, DNA and how it works
  • Where to find DNA sequences
  • How to program bacteria
  • BioBricks
  • Introduction on what to do next (get DNA, insert it in bacteria)


  • U_go

atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtg aaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatgg tgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttc aaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatg gaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaat tagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattac ctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatgg atgaactatacaaataataa #CRC32 ERROR


___ Chemistry 1o1 ___

mendeliev's table of elements:

neutrons change the weight, not the behavior

      1         : nr of electrons in diff layers

1  : nr of protons H hydrogen  : name 1.00794  : average mass

                 (as there is a some deuterium en tritium it is not equal to 1)

adding neutrons doesn't change behavior of atoms

       2 : 2 electrons on first layer
       1 : 1 electron on second layer

3 Li

what keeps an atom together? Strong nuclear force

last column: noble gasses; inert left: akalines : release OH right:acids : release hydrogen

solvent : brownian motion : particles moving because of temperature

C-N-O and H are basics for organic chemistry Fe : used for instance in hemoglobine Mg : eg in clorophyl

fun videos each element comes with a very entertaining video that explains the properties of the element.

___ Biology ___

dna is one molecule (in fact 2 molecules, each strand of the helix is one molecule) dna is an acid and reacts well with base

4 bases {A,T,C,G}

sugars: cycle(s) with one oxygen and 4or5 carbon atoms etc saccharose

___ Genomes ___

3 main groups of organisms

- bacteria: difficult to see with microscope (eg diameter of red blood cell 7 micron, diameter of bacteria - 1 micron) - archaea (looks like bacteria, but with very different dna, living in very exotic environments - eg vulcanic lakes, ice etc) - eukaryota (complex cells, groups) plants, fungi, animals

bacteria - escherichia coli duplicates every 20min cells in human body duplicate every 24h (eg skincells,..)

fly -- drosophila melanogaster -- small genome

yeast 13 Mbp (mega-base-pairs) 16 chromosomes 25% common genome with man

human 3Gbp promoter-rbs-gene-stop

protein viz pymol/rasmol

find proteins:

Download complete genomes :

=> Main repository

=> Bacteria E. coli

=> Fly D. melanogaster (5 chromosomes : X, Y, 2, 3, 4)

___ Genomics ___

=> Green Fluorescent Protein

=> PyMOL ! Might need to register (Lucid) (SVN) => Alternative : RasMol

=> Green Fluorescent Protein (GFP) on Protein Database (PDB)

___ Hands on ___